BCL2, apoptosis regulator(BCL2)Homo sapiens. This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016],
Catalog No
N1305
Reactivity
Human,Mouse,Rat,chicken
Applications
IF/ICC,WB,IHC-p
Modification
Unmodfied/ Total
Source
Monoclonal Mouse
Dilution
IF: 1:50-200 WB: 1:1000~2000 IHC: 1:200
Purification
The antibody was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen.
Concentration
Storage and Stability
-20°C/1 year
Other Name
BCL2; Apoptosis regulator Bcl-2
Molecular Weight (Da)
26266
Gene Name
BCL2
Protein Name
Apoptosis regulator Bcl-2
Human Gene ID
596
Human Swiss Prot No.
P10415
Immunogen
Synthetic Peptide of Bcl-2
Specificity
The antibody detects endogenous Bcl-2 proteins.
Formulation
PBS, pH 7.4, containing 0.5%BSA, 0.02% sodium azide as Preservative and 50% Glycerol.
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:400(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:400(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:400(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:200(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Fallopian tube. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:200(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:200(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:200(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human Lymph gland. 1. Antibody was diluted at 1:100(4° overnight). 2. High-pressure and temperature EDTA. pH8.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 30min).
Immunohistochemical analysis of paraffin-embedded Human breast cancer. 1. Using Bcl-2 Mouse mAb (N1305) diluted at 1:200 (4° overnight). 2. High-pressure and temperature Citric acid. pH6.0 was used for antigen retrieval. 3.Secondary antibody was diluted at 1:200(room temperature. 50min). Picture was kindly provided by our customer from Tianjin Medical University Cancer Institute and Hospital
Western blot detection of Bcl-2 in human breast cancer cell line MCF-7(A). MDA-MB-231(B) and Cal51(C) using Bcl-2 mouse mAb (N1305. 1:2000 diluted).Predicted band size: 26kDa.Observed band size:26kDa. Picture was kindly provided by our customer from Tianjin Medical University Cancer Institute and Hospital
Western blot analysis of lysates from 1)Hela. 2) MCF-7 cells. (Green) primary antibody was diluted at 1:1000. 4°over night. secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37° 1hour. (Red) Actin β Polyclonal Antibody (Assay Biotech:C40022) antibody was diluted at 1:5000 as loading control. 4° over night.Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37° 1hour.
He. Fenglian. et al. "Synergistic effect of Notch-3-specific inhibition and paclitaxel in non-small cell lung cancer (NSCLC) cells via activation of the intrinsic apoptosis pathway." Medical science monitor: international medical journal of experimental and clinical research 23 (2017): 3760.
Yu. Xiao. et al. "The modified Yi qi decoction protects cardiac ischemia-reperfusion induced injury in rats." BMC complementary and alternative medicine 17.1 (2017): 330.
Tao. Yuquan. et al. "Huaier Augmented the Chemotherapeutic Sensitivity of Oxaliplatin via Downregulation of YAP in Hepatocellular Carcinoma." Journal of Cancer 9.21 (2018): 3962.
Wen. Yao-An. et al. "Phosphoglycerate mutase 1 knockdown inhibits prostate cancer cell growth. migration. and invasion." Asian journal of andrology 20.2 (2018): 178.
Western blot analysis of lysates from 1)Hela cell. 2)Hela cells knockdown by siRNA1 (F:GGAUGACUGAGUACCUGAATT.R:UUCAGGUACUCAGUCAUCCTT) siRNA2(F:GUGAUGAAGUACAUCCAUUAU.R:AUAAUGGAUGUACUUCAUCAC). (Green) primary antibody was diluted at 1:1000. 4°over night. Dylight 800 secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37° 1hour. (Red) GAPDH rabbit (Assay Biotech:C40021) antibody was diluted at 1:5000 as loading control. 4° over night. Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37° 1hour.
Immunofluorescence analysis of Hela cell. 1.Dnmt3b Polyclonal Antibody(red) was diluted at 1:200(4° overnight). Bcl-2 Monoclonal Antibody(6B5)(green) was diluted at 1:200(4° overnight). 2. Goat Anti Rabbit Alexa Fluor 594 Catalog:SA0837 was diluted at 1:1000(room temperature. 50min). Goat Anti Mouse Alexa Fluor 488 Catalog:SA0662 was diluted at 1:1000(room temperature. 50min).
Zhang. J.. Wong. C.C.. Leung. K.T. et al. FGF18–FGFR2 signaling triggers the activation of c-Jun–YAP1 axis to promote carcinogenesis in a subgroup of gastric cancer patients and indicates translational potential. Oncogene 39. 6647–6663 (2020).
Author:
Zhou Qi, Xiang Hong, Liu Han, Qi Bing, Shi Xueying, Guo Wenhui, Zou Jiacheng, Wan Xueting, Wu Wenjing, Wang Zhengpeng, Liu Wenhui, Xia Shilin, Shang Dong
